Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Load*

-

Import file with OpenBabel


CommandArgument DatatypeDefaultMinMax
Format:Load*Filename = Filename of molecule, STRING- - -
   Center = Yes | No,STRING Yes --
  Resonate = Yes | NoSTRING Yes --
Python:This command is mainly for internal use. It is not available in Python.
Menu:File > Load > Other fileformat
Related:LoadPDB, LoadSce , LoadYOb, Save*
Required:


The Load* command invokes OpenBabel to import a molecule saved in the file format of another program. The star '*' stands for any of the supported file extensions, listed on the left side of the selection window that appears when you click File > Load > Other fileformat.

If the Center flag is set, the object is shifted so that its mean atom position coincides with the origin of its local coordinate system. This makes sure that rotations with the mouse feel natural.

The Resonate flag tells YASARA to automatically replace alternating single/double bonds in the molecule with the corresponding resonance forms, implicitly assuming that no hydrogens are missing in the molecule. Disable this flag to see the original bond orders specified in the file. You can then correct the bond orders later or just reassign them completely.

If you want a newly loaded object to fall on top of another object, you have three possibilities:
  • Load the objects right after each other with the 'Center' option disabled.
  • Transfer one object to the coordinate system of the other object.
  • Superpose the objects.

Should you have problems importing files, go to subdirectory bab/ and try to run babel/babel.app/babel.exe manually, e.g. convert your exotic file format to PDB and look at the output. If that also fails, please report the problem directly at http://openbabel.sourceforge.net.

Example 1:
LoadMOPCRT atp

Load the MOPAC file atp, atp.mopcrt or mopcrt/atp.mopcrt.


Example 2:
LoadMOPCRT atp,Center=No

As above, but do not shift the mean atom position to 0/0/0.


Example 3:
obj = LoadMOL2 atp,Resonate=No

Load the MOL2 file atp.mol2 or mol2/atp.mol2, but do not automatically replace alternating single/double bonds with the resonance forms. Assign the number of the created object to variable 'obj'.