Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

ListRest<Atom|Res|Mol|Obj|All>

-

List restraints and energies


CommandArgument DatatypeDefaultMinMax
Format:ListRest<Atom|Res|Mol|Obj|All> Selection, SELECTION- - -
   Class = Restraint class name, STRINGAll - -
   Component = All | Distance | Dihedral,STRINGAll - -
   Format = PDB | PDB3 | PDBRev | YASARA | IUPAC | XPLOR,STRINGPDB- -
   Sort = Yes | NoSTRINGNo - -
Python: ListRest<Atom|Res|Mol|Obj|All>(selection1,Class=None,component=None,format=None,sort=None)
Menu:Simulation > List restraints
Related: ShowRest , HideRest, ScaleRest , DelRest, RestEnergy , RestViol, LoadTbl , RestrainDis, RestrainDih , RestrainPot, RestrainPar
Required:and the NMR Structure Determination Module


The ListRest command lists those restraints that involve at least one selected atom.

The list includes the current restraint distance calculated with the selected distance averaging function as well as the energy according to the respective restraining potential.

Results are returned in units of either kJ/mol or kcal/mol, depending on the current EnergyUnit.

The atom names displayed can be influenced with the Format parameter, as described at the SavePDB command. If the restraints were read from a file in XPLOR format , choose the 'XPLOR' format to list restraints with the original atom names.

If the Sort parameter is set to 'Yes',the restraints will be sorted by violation energy.

Example 1:
ListRestAll

List all restraints.


Example 2:
ListRestObj 5,sort=Yes

List the restraints in object 5 and sort them by violation energy.


Example 3:
ListRestMol A,Dihedral

List the dihedral angle restraints in molecule A.


Example 4:
ListRestAtom H,Distance

List all distance restraints involving backbone amide hydrogens.