Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

ListMenu

-

Add a menu allowing to select from a list

This keyword adds a window with a list of options. Set the 'MultipleSelections' flag to 'Yes' if the user is allowed to select more than one list entry and to 'No' otherwise. The first text is displayed above the list, the other texts are the actual list entries.

The jth selected list entry in the ith selection menu can be accessed by the Python plugin as yasara.selection[i].listentry[j] (see below).

Example:

MainMenu: Analyze
  PullDownMenu: _P_DBFinder2 properties
    ResidueSelectionMenu: Select residues to color by PDBFinder2 properties
    ListMenu: Select PDBFinder2 properties
      MultipleSelections: Yes
      Text: Select more than one list entry to color by the average value
      Text: Nalign - Number of HSSP alignments
      Text: Nindel - Number of insertions and deletions
      Text: Entropy - HSSP sequence entropy
    Request: ColorResidues