Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

ListHBo<Atom|Res|Mol|Obj>

-

List hydrogen bonds


CommandArgument DatatypeDefaultMinMax
Format:ListHBo<Atom|Res|Mol|Obj> Selection 1, SELECTION- - -
   Selection 2SELECTION---
Python:resultlist = ListHBo<Atom|Res|Mol|Obj>(selection1,selection2)
Menu:Analyze > H-Bonds between
Related: ListCon , List, Format , ShowHBo, HideHBo
Required:


The ListHBo command lists all atoms in the first selection that are hydrogen bonded to atoms in the second selection. Atoms separated by up to three covalent bonds are always excluded from the analysis.

The definition of a hydrogen bond is that the distance between the hydrogen and the hydrogen bond acceptor is smaller than 2.5 A. This implies that hydrogens have been added .

For best results, the hydrogen bonding network should be optimized , using either the OptHyd command in the Twinset or an energy minimization in YASARA Dynamics.

Since residue numbers and molecule names may not be unique , the commands 'ListHBoRes' and 'ListHBoMol' return unique strings instead, as explained here.

Hydrogen bonds between different objects can only be listed when the objects share the same local coordinate system.

Example 1:
ListHBoMol A,B

List all hydrogen bonds between molecules A and B.


Example 2:
ListHBoRes Arg,Glu

List all hydrogen bonds between arginines and glutamates.


Example 3:
mylist() = ListHBoAtom Element N,Element O

Assign the numbers of all nitrogen atoms that are hydrogen bonded to oxygens to 'mylist'.


Example 4:
mylist() = ListHBoRes Mol A,Mol B

Assign the unique IDs of all residues in molecule A that are hydrogen bonded to molecule B to 'mylist'.