Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

ListFloat<Obj|All>

-

List floating assignments


CommandArgument DatatypeDefaultMinMax
Format:ListFloat<Obj|All>Object selection, SELECTION---
  Type = All | Swapped,STRING All --
  Format = PDB | PDB3 | PDBRev | YASARA | IUPAC | XPLORSTRINGPDB - -
Python: ListFloat<Obj|All>(selection1,Type=None,format=None)
Menu:This command is mainly useful for macros. There is no menu entry.
Related:RestrainDis, RestrainDih, RestrainPot , RestrainPar, ScaleRest , ShowRest, HideRest , DelRest, ListRest
Required:and the NMR Structure Determination Module


The ListFloat command lists either all or only the swapped floating assignments in the selected objects.

The output format is similar to ARIA's SaveFloat command and thus facilitates YASARA's use in automated assignment of NMR spectra, the various atom naming conventions are listed here .

The details of floating assignments are explained here .

Example output ('REVE' marks swapped floating assignments):

Floating assignments in object 1 (3gb1_mes):
KEEP ((segid "    " and resid   54 and name #HG1) or (segid "    " and resid   54 and name #HG2))
KEEP ((segid "    " and resid   39 and name #HG2) or (segid "    " and resid   39 and name #HG1))
REVE ((segid "    " and resid   29 and name #HG2) or (segid "    " and resid   29 and name #HG1))
KEEP ((segid "    " and resid   21 and name #HG2) or (segid "    " and resid   21 and name #HG1))
REVE ((segid "    " and resid    7 and name #HD2) or (segid "    " and resid    7 and name #HD1))
KEEP ((segid "    " and resid   12 and name #HD1) or (segid "    " and resid   12 and name #HD2))
KEEP ((segid "    " and resid    5 and name #HD1) or (segid "    " and resid    5 and name #HD2))


Example 1:
ListFloatObj 3gb1,Format=XPLOR

List all floating assignments in object 3gb1 using XPLOR hydrogen names.


Example 2:
ListFloatObj 3gb1,Type=Swapped,Format=PDB

List only the swapped floating assignments in object 3gb1 using PDB hydrogen names.