Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

ListCon<Atom|Res|Mol|Obj>

-

List contacts


CommandArgument DatatypeDefaultMinMax
Format:ListCon<Atom|Res|Mol|Obj> Selection 1, SELECTION- - -
   Selection 2,SELECTION - --
  Cutoff = Contact distance cutoff in ÅFLOAT 4.0 --
Python:resultlist = ListCon<Atom|Res|Mol|Obj>(selection1,selection2,cutoff=None)
Menu:Analyze > Contacts between
Related: ListHBo , List, Format
Required:


The ListCon command lists those distances between atoms in the first selection and atoms in the second selection that are shorter than the specified cutoff. Atoms separated by up to three covalent bonds are always excluded from the analysis .

If the command extension is 'Res', 'Mol' or 'Obj', the contacts are not listed individually, but instead summed up for all atoms in the selected unit. The resulting number thus indicates contact strength, e.g. the more contacts are found between the atoms of two residues, the stronger the contact between the residues.

Since residue numbers and molecule names may not be unique, the commands 'ListConRes' and 'ListConMol' return unique strings instead, as explained here .

Contacts between different objects can only be listed when the objects share the same local coordinate system.

Example 1:
ListConAtom CA,CA,Cutoff=5

List all Calpha-Calpha contacts that are shorter than 5 A.


Example 2:
ListConAtom Res Thr 2,Res Arg 10

List all contacts between atoms in residues Thr 2 and Arg 10 (distances < 4 A).


Example 3:
ListConRes Thr 2,Arg 10

List the number of contacts between residues Thr 2 and Arg 10.


Example 4:
mylist() = ListConAtom Mol A,Mol B

Assign the numbers of all atoms in molecule A that are in contact with molecule B to 'mylist'.


Example 5:
mylist() = ListConRes Lys,Asp

Assign the unique IDs of all lysine residues that are in contact with aspartates to 'mylist'.