Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Link<Atom|Res|Mol|Obj|All>

-

Find bonds automatically


CommandArgument DatatypeDefaultMinMax
Format:Link<Atom|Res|Mol|Obj|All> Selection, SELECTION- - -
   Deviation = Maximum allowed bond length deviation in %FLOAT25.0- -
Python:Link<Atom|Res|Mol|Obj|All>(selection1,deviation=None)
Menu:Edit > Find links
Related:AddBond , DelBond
Required:


The Link command measures the distances between all atoms in the selection and adds a bond whenever two atoms are close enough. 'Close enough' means that their distance is smaller than the sum of their bond radii multiplied with 100% plus the allowed deviation:


(1)

The bond orders of the newly added bonds are also assigned automatically .

As interactions with metal ions are treated purely electrostatically during molecular dynamics simulations, they should not be selected with Link to avoid the accidental assignment of covalent bonds.

Link assigns a maximum of four covalent bonds per atom.

Example 1:
LinkRes Man

Link all atoms in residues named 'Man' that are close enough to form a bond.


Example 2:
LinkMol C,Deviation=50%

Link all atoms in molecule 'C' that are close in space, even those that are 50% further apart than the sum of their bond radii.