Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Labels allow to jump back and forth between movie sections

Every new section in your movie should start with a label, followed by the Clear command.


#
# SLIDE 1: Title Page
#
TitlePage:
Clear
LoadPDB 1crn

The label makes sure that you can jump to this point using any of these methods:

  • The forward and backward buttons in the top menu line.

  • The Go commands you can find at Options > Macro & Movie.

  • If the menus are switched off, look at the Macro & Movie option in the context menu (RightClick on the background).

  • Pass the name of the label to the PlayMacro command.

The Clear command sets YASARA to a defined state, which is important because the user can jump to a label at any time while a macro is executed. In case you do not want to clear everything (e.g. some logos you loaded as image 1 and which you want to display during the entire presentation), use your own Clear command:


TitlePage:
# MyClear: Delete all objects and all but the first image
DelObj All
DelImage !1

If you want to temporarily skip a section during development, just comment it out using triple quotes """ in the beginning and the end.