Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Your guide to YASARA View



° 

Essentials

-

What you really have to know


° 

Selections

-

Tell YASARA what you want


° 

Commands

-

Tell YASARA what to do


° 

Recipes

-

Answer complex questions


° 

Macros

-

Automate your work with Yanaconda


° 

Macros can be recorded or written manually

° 

Yanaconda is Yet ANother Abridged COding 'N' Development Approach

° 

Yanaconda is a reinterpreted language

° 

Explicit evaluators modify the source code at run time

° 

When writing Yanaconda macros, use Python syntax highlighting

° 

The four datatypes are integer, float, weak string and strong string

° 

The left operand defines the datatype of the result

° 

Yanaconda supports the usual operators

° 

Indentation defines the program flow and must be a multiple of two spaces

° 

Control the program flow with if, elif and else

° 

There are four types of loops

° 

Lists are emulated with explicit evaluators


° 

Matrices are two dimensional lists

° 

The 'count' function determines the length of lists

° 

The 'min', 'max', 'sum', 'mean', 'stddev' and 'join' functions return the smallest, largest, sum, mean, standard deviation and concatenation of all list elements

° 

Lists can be sorted

° 

Yanaconda macros can access predefined variables

° 

Yanaconda macros can include each other

° 

Calls to built in functions can be placed anywhere within an expression

° 

Calls to YASARA commands must appear one per line

° 

Macros can be speeded up by switching off the console


° 

Plugins

-

Extend YASARA with your own functions


° 

Scripts

-

Use YASARA as a Python module


° 

Troubleshooting

-

Get things going