Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

LabelPar

-

Set label parameters


CommandArgument DatatypeDefaultMinMax
Format:LabelPar Font = Font name or number,STRING ---
   Height = Label height in Angstroms in Å, FLOAT1.0--
  Color = Label color, RGBCOLORWhite--
  OnTop = Yes | No,STRING No --
  Shrink = Yes | No,STRING Yes --
  Fog = Yes | NoSTRINGYes--
Python:LabelPar(font,height=None,color=None,ontop=None,shrink=None,fog=None)
Menu:Effects > Label > Parameters
Related:Label, Unlabel
Required:


YASARA currently supports four fonts: Arial, Times, Baikal and Symbol.

Example:
LabelPar Font=Baikal,Height=2,Color=Red,OnTop=Yes,Shrink=No,Fog=No

Display all labels with a red Baikal font, 2 A high, on top of the scene, with a constant size (independent of the Z-coordinate) and no fog.