Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

LabelDis

-

Label atom distances


CommandArgument DatatypeDefaultMinMax
Format:LabelDis Atom selection 1, SELECTION- - -
   Atom selection 2,SELECTION - --
  Format = Label format, STRING---
  Height = Label height in Angstroms in Å,FLOAT 1.0 --
  Color = Label color, RGBCOLORWhite--
  X = X-Step from atom to label in Å,FLOAT 0.0 --
  Y = Y-Step from atom to label in Å,FLOAT 0.0 --
  Z = Z-Step from atom to label in Å,FLOAT 0.0 --
  bound = Yes | NoSTRINGNo--
Python:LabelDis(selection1,selection2,format,height=None,color=None,x=None,y=None,z=None,bound=None)
Menu:Effects > Label > Distance
Related: UnlabelDis , LabelPar, ShowArrow
Required:


The LabelDis command places a label halfway between selected pairs of atoms.

If the characters 'DIS' appear in the format string, they will be replaced with the actual distance between the atoms. The format string may also contain these HTML-like tags:

<U> goes up, <D> down, <G> switches to Greek and <L> back to Latin letters.

The bound flag allows to label only distances between bound atoms, i.e. bond lengths.

The label is always linked to the first atom in the distance pair. Deleting this atom will therefore delete the label as a side-effect.

Example 1:
LabelDis O Res Gly 20,OE1 Res Glu 23,Distance is DIS,Red

Print the red text "Distance is 9.8" halfway between the two specified atoms in 1crn.


Example 2:
LabelDis 1,CA,DIS,Height=0.5

Show the distances between atom 1 and all CA atoms.


Example 3:
LabelDis Obj 1,Obj 1,Height=0.2,bound=Yes

Label all bond lengths in object 1.



Example macro:

# EXAMPLE LabelDis
Clear
LoadPDB 1crn
Style Stick
LabelDis 1,CA,Format=DIS,Height=1,Color=Green
ShowArrow AtAtom,1,AtAtom,CA,Radius=0.1,Color=Yellow
PosObj 1crn,Z=20

Figure: Result of the example macro above.