Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Label<Atom|Res|Seg|Mol|Obj|All>

-

Add labels


CommandArgument DatatypeDefaultMinMax
Format:Label<Atom|Res|Seg|Mol|Obj|All> Selection, SELECTION- - -
   Format = Label format,STRING - --
  Height = Label height in Angstroms in Å,FLOAT 1.0 --
  Color = Label color, RGBCOLORWhite--
  X = X-Step from atom to label in Å,FLOAT 0.0 --
  Y = Y-Step from atom to label in Å,FLOAT 0.0 --
  Z = Z-Step from atom to label in ÅFLOAT 0.0 --
Python:Label<Atom|Res|Seg|Mol|Obj|All>(selection1,format,height=None,color=None,x=None,y=None,z=None)
Menu:Effects > Label
Related: LabelPar , Unlabel, LabelDis , ShowArrow
Required:


The Label command attaches a label to the selected units, that may contain explicit text as well as unit properties as part of a format string. Unit properties are accessed with the following (case sensitive) keywords:

OBJNAME The object name
OBJNUM The object number in the soup
MOLNAME The molecule name
SEGNAME The segment name
RES The complete residue ID
RESNAME The residue name in upper case
RESName The residue name in mixed case
RESNAME1 The residue name in one letter code
RESNUM The residue number
ATOMNAME The atom name
ATOMNUM The atom number
ATOMTYPE The atom type, shown as '?' if no force field has been initialized yet .
ATOMCHARGEThe atom charge, either in the current force field (if initialized) or just the formal charge calculated from bond orders and standard valences.

The label can be formatted with the following tags: <U> goes up, <D> down, <G> switches to Greek and <L> back to Latin letters.

YASARA knows five different kinds of labels: scene, object, molecule, residue and atom labels, selected via the command extensions 'All', 'Obj', 'Mol', 'Res' and 'Atom'. Labels always try to stay in front of the respective unit when the scene rotates on screen.

To delete labels with Unlabel , the same command extension must be used, e.g. labels created with LabelRes can only be deleted with UnlabelRes , but not with UnlabelAtom or UnlabelAll.

The label is always linked to the first atom in the selected unit, deleting this atom will therefore delete the label as a side-effect. That is why at least one atom needs to be present to label the scene.

Example 1:
LabelObj 1crn,This is object OBJNAME,2.5

Show the label "This is object 1crn" on top of object 1crn, with letters 2.5 Angstroms high.


Example 2:
LabelRes 20,RESName number RESNUM in OBJNAME,3

Show the label "Gly number 20 in 1crn" on top of residue 20, with letters 3 Angstroms high.


Example 3:
LabelRes Lys,RES

Label all lysine residues.


Example 4:
LabelRes Cys 16,This is Cys<U>16<D> in <G>a<L>-Helix<D>1<U>

Show a residue label with format tags.


Example 5:
LabelAtom CA,ATOMNAME

Label all Calpha atoms with their name "CA".


Example 6:
LabelAtom all,ATOMNUM

Label all atom with their sequential number.


Example 7:
LabelAll MyScene

Show the label "MyScene" in the middle of the screen.



Example macro 1:

# EXAMPLE Label All
Clear
LoadPDB 1crn
Style Ball
LabelAll My Scene Label,Color=Yellow

Figure: Result of the example macro 1 above.



Example macro 2:

# EXAMPLE Label Object
Clear
LoadPDB 1crn
Style BallStick
LabelObj 1crn,This is OBJNAME,Height=2,Color=Yellow
PosObj 1crn,Z=20

Figure: Result of the example macro 2 above.



Example macro 3:

# EXAMPLE Label Residue
Clear
LoadPDB 1crn
Style Stick
LabelRes All,RESName RESNUM,Height=1,Color=Yellow
PosObj 1crn,Z=20

Figure: Result of the example macro 3 above.



Example macro 4:

# EXAMPLE Label Residue 2
Clear
LoadPDB 1crn
OriObj 1crn,Alpha=-95,Beta=114
PosObj 1crn,Y=2.7,Z=31
Style Tube
ShowRes Cys 16
Stick
# Note the tags: <U> goes up, <D> down, <G> switches to Greek, <L> back to Latin letters
text='This is RESName<U>RESNUM<D> in <G>a<L>-Helix<D>1<U> going d<D>o<D>w<D>n'
LabelRes Cys 16,(text),Height=1.0,Color=Black,Y=-1.5

Figure: Result of the example macro 4 above.



Example macro 5:

# EXAMPLE Label Atom
Clear
LoadPDB 1crn
Style Stick
LabelAtom CA,ATOMNAME,Height=1,Color=Yellow
PosObj 1crn,Z=20

Figure: Result of the example macro 5 above.