Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Known inconveniences

There are a handful of 'features' that look like bugs, but cannot be fixed without a severe impact on performance or other important factors:

  • If you resize the YASARA window, it may jump to a different location. This behavior is required by YASARA's graphics engine. If you are using two monitors, look here for more details.

  • If you put a window that is always on top (e.g. the Windows task manager) in front of the YASARA window, activate a YASARA menu entry, and move the other window away, a copy of this window may remain visible until you leave the YASARA menus. It depends on your OpenGL driver whether or not this behavior can be observed.

  • If your keyboard contains special characters (German 'Umlaute', French characters with accents etc.), these keys will not work. The main reason is that using these characters would render your macros or movies unusable for people with a different operating system, creating a chain of troubles, which we decided to break in the beginning. Also YASARA's vector fonts usually do not contain these characters, so they could not be displayed anyway.

  • When using semi-transparent surfaces combined with YASARA's built in antialiasing, there may be thin borders around some atoms. This is normal OpenGL behavior. The only workaround is to disable YASARA's antialiasing and activate OpenGL hardware antialiasing in the settings of your video card.