Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

KekulizeBond

-

Remove fractional bond orders


CommandArgumentDatatypeDefault Min Max
Format: KekulizeBond Atom selection 1,SELECTION ---
   Atom selection 2SELECTION ---
Python: KekulizeBond(selection1,selection2)
Menu:Edit > Adjust bond orders > Kekulize bond
Related:ResonateBond, TypeBond , AddBond, DelBond , Link
Required:


The KekulizeBond command reassigns the orders of all selected bonds such that resonance bonds are replaced with either single or double bonds.

KekulizeBond is called automatically when saving molecules in a format that does not support fractional bond orders, e.g. mol2.

Example 1:
KekulizeBond all,all

Replace all fractional bond orders with conjugated single/double bonds.


Example 2:
KekulizeBond CZ Res Arg,NE NH? Res Arg

Kekulize the fractional bond orders between atoms CZ and NE,NH1,NH2 in arginines.