Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

JoinObj

-

Join objects to one final object


CommandArgumentDatatypeDefault Min Max
Format: JoinObj Object selection source,SELECTION ---
   Object selection destination,SELECTION-- -
   Center = Yes | NoSTRINGYes - -
Python: JoinObj(selection1,selection2,center=None)
Menu:Edit > Join > Object
Related: JoinAtom , SplitObj, SplitAtom
Required:


The newly joined object contains "split points" at the original object boundaries. SplitObj can be used to reverse the joining. Split points correspond to TER entries in a PDB file, they can be added with SplitMol, SplitRes or SplitAtom and removed with JoinMol, JoinRes or JoinAtom . Split points show up as a single vertical line in the sequence selector at the bottom. The concept is similar to WHAT IF's Cut and Paste, but called differently because Cut and Paste are functions associated with the clipboard.

If the Center flag is set, the object is shifted such that its mean atom position coincides with the origin of its local coordinate system. This makes sure that rotations with the mouse feel natural. When exporting an object, these transformations can be undone by checking the 'Transform' button.

Example 1:
JoinObj 2,1

Join object 2 with object 1, object 2 is left empty.


Example 2:
JoinObj 4-6,2,Center=No

Join objects 4,5 and 6 with object 2 and do not center the now larger object 2.