Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Join<Atom|Res|Mol>

-

Delete split points


CommandArgument DatatypeDefaultMinMax
Format:Join<Atom|Res|Mol> Selection SELECTION- - -
Python: Join<Atom|Res|Mol>(selection1)
Menu:Edit > Join
Related: JoinObj , SplitObj, SplitAtom
Required:


The Join command removes the split points (molecule boundaries) just before the selected units.

Split points show up as a single vertical line in the sequence selector at the bottom and as 'TER' entries in PDB files.

The concept is similar to WHAT IF's Cut and Paste, but called differently because Cut and Paste are functions associated with the clipboard.

Example 1:
JoinMol A

Remove split points before all molecules named A.


Example 2:
JoinRes 400

Remove split points before all residues numbered 400.


Example 3:
JoinAtom 1345

Remove the split point before atom 1345.