Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

It takes too long till the menu appears

A trivial first solution is to disable window animations: click on Window > Animation > Off.

Then make sure that you have hardware accelerated OpenGL support installed .

If you are using old drivers for ATI Radeon and Matrox G400-G550 cards, it may take half a second for the menu to appear. Owners of a Radeon 8500 card and above can simply update the driver, this will solve the problem. For cards older than the Radeon 8500, this may help as well, please report your experience. For Matrox owners, updating the driver can even make things worse, and it's probably best to just get a new graphics card.