Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Integers remember the number of leading zeroes

Integers are numbers without a decimal point. Contrary to other programming languages, they can be defined with leading zeroes and remember them.

Examples:

a = 5
b = -4003
c = 000
d = 000005

To wheat your appetite, here is an example which takes away some things explained later, but illustrates the point. Imagine you want to load 10 PDB files, named Model001 to Model010.

As a C programmer, you would type:


char filename[9];
int i;

for (i=1;i<=10;i++)
{ sprintf(filename,"Model%03d",i);
  LoadPDB(filename); }

As a Python programmer, you save a lot and earn percents and a mysterious '11':


for i in range(1,11):
  LoadPDB("Model%03d"%i)

As a Yanaconda programmer, your life is easy:


for i=001 to 010
  LoadPDB Model(i)