Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Interactions

-

Set force field terms


CommandArgument DatatypeDefaultMinMax
Format:Interactions Type = Bond | Angle | Dihedral | Planarity | VdW | Coulomb | All | None STRING---
Python:Interactions(Type)
Menu:Simulation > Force field
Related: ForceField , Longrange, Cutoff , ScaleForce
Required:


The Interactions command allows to selectively deactivate force field components.

Not all combinations of interactions are currently supported. With the NOVA force field, Planarity, Coulomb or (Coulomb+VdW) interactions can be disabled. With AMBER style force fields (including YAMBER), VdW interactions can only be disabled together with Coulomb interactions, and planarity interactions are always linked to the setting for dihedral interactions.

The ForceField and Reset commands reactivate all interactions.

Example 1:
Interactions All

Calculate all interactions during simulation.


Example 2:
Interactions Bond,Angle,Dihedral,Planarity

Do not calculate intermolecular forces (Coulomb,VdW).


Example 3:
Interactions Bond,Angle,Dihedral,Planarity,VdW

Calculate all except Coulomb forces.