Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Handling special cases like Cys-bridges, oligomers and metalloproteins

If you are trying to solve an unusual protein structure, here are some hints:

  • Treating cysteine bridges: The initial folding step is always done with protonated SG atoms and thus without cysteine bridges. If you know from some other experiment which cysteines are bridged, store the residue numbers in 'cysbridgelist' (see nmr_setdefaults). Alternatively, YASARA can automatically link cysteines that get close enough during the refinement in vacuo.

  • Treating metal binding sites with ions: Put the distance restraints involving ions into a second restraint file and run the initial folding step without any ions present. Then add the ions, place them at the center of the protein and then continue with step 2 and both restraint files.

  • Special residue numbering: If the first residue in the sequence does not have the number '1' in the restraint file, the easiest solution is to renumber the residues using the RenumberRes command, right after the linear peptide chain has been built in nmr_fold by the BuildMol command.