Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

HideSurf<Atom|Res|Mol|Obj|All>

-

Hide surface


CommandArgument DatatypeDefaultMinMax
Format:HideSurf<Atom|Res|Mol|Obj|All> Selection, SELECTION- - -
   Type = VdW | Molecular | Accessible | AllSTRINGAll - -
Python: HideSurf<Atom|Res|Mol|Obj|All>(selection1,Type=None)
Menu:View > Hide surface
Related: ShowSurf , ColorSurf, Surf , SurfPar, AddEnv , RemoveEnv
Required:


Static surface objects must instead be deleted instead.

Example 1:
HideSurfAll

Hide all dynamic surfaces.


Example 2:
HideSurfAll Accessible

Hide all dynamic accessible surfaces.


Example 3:
HideSurfObj 1crn

Hide all dynamic surfaces of object 1crn.


Example 4:
HideSurfObj 5,Molecular

Hide the dynamic molecular surface of object 5.


Example 5:
HideSurfRes Lys,VdW

Hide the dynamic Van der Waals surface of all Lysine residues.