Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

HideSecStr<Res|Mol|Obj|All>

-

Hide secondary structure


CommandArgument DatatypeDefaultMinMax
Format:HideSecStr<Res|Mol|Obj|All> Selection, SELECTION- - -
   ShowAtoms = Yes | NoSTRING No --
Python:HideSecStr<Res|Mol|Obj|All>(selection1,showatoms=None)
Menu:View > Hide secondary structure
Related:ShowSecStr, SecStr , SecStrPar, Hide , Show
Required:


The HideSecStr command hides a tube, ribbon or cartoon secondary structure representation that {has been shown beforeShowSecStr.

Example 1:
HideSecStrRes 20-30

Hide any secondary structure at residues 20-30.


Example 2:
HideSecStrObj 1crn,ShowAtoms=Yes

Hide the secondary structure of object 1, and show all atoms again.