Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

HideRest<Atom|Res|Mol|Obj|All>

-

Hide restraints


CommandArgument DatatypeDefaultMinMax
Format:HideRest<Atom|Res|Mol|Obj|All> Selection, SELECTION- - -
   Class = Restraint class name STRINGAll - -
Python: HideRest<Atom|Res|Mol|Obj|All>(selection1,Class=None)
Menu:Simulation > Hide restraints
Related: ShowRest , DelRest, ListRest , LoadTbl, RestrainDis , RestrainDih, RestrainPot , RestrainPar, RestEnergy , RestViol
Required: and the NMR Structure Determination Module


The HideRest command hides those distance or dihedral angle restraints that involve one of the selected atoms.

The Class parameter allows to select a certain restraint class. In addition to class names specified when loading the restraints , the built-in names 'Violate' and 'Fulfill' select violated and fulfilled restraints respectively.

Example 1:
HideRestAll

Hide all restraints.


Example 2:
HideRestMol A

Hide restraints involving molecule A.


Example 3:
HideRestAll Class=Fulfill

Hide all fulfilled restraints.


Example 4:
HideRestAtom globalY>0

Hide those restraints involving atoms in the upper half of the screen.