Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

HideArrow<Atom|Res|Mol|Obj|All>

-

Hide arrows


CommandArgument DatatypeDefaultMinMax
Format:HideArrow<Atom|Res|Mol|Obj|All> Selection SELECTION- - -
Python: HideArrow<Atom|Res|Mol|Obj|All>(selection1)
Menu:Effects > Hide arrows from
Related: ShowArrow
Required:


The HideArrow command hides all arrows pointing to or from a selected atom.

Example 1:
HideArrowRes 20-30

Hide any arrows linked to atoms in residues 20 to 30.


Example 2:
HideArrowAll

Hide all arrows.