Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Hints for using movies in important presentations

When you base your talk at a scientific conference or job interview on a YASARA movie, consider the following hints to make everything run smoothly:

  • Use Labels for each section to make sure that you can easily jump there via the context menu in reply to questions from the audience. Choose obvious names, not 'SlideX'.

  • Keep in mind that jumping to a label does not influence the scene or simulation parameters. Even if the first command after a label is Clear, the force field will still be the same as before the jump. Hence if a certain slide does not specify a force field but runs a simulation, it will use whichever force field was selected before the jump. In short, make sure to set ForceField, Cutoff, Interactions, Boundary, Longrange, TimeStep, SimSteps and TempCtrl correctly in each slide that shows a simulation.

  • When running a simulation, use 'Sim Pause,in=...' to make sure that it does not continue forever. Otherwise, if your talk takes longer than expected, you will impress your audience with a real-time simulation you have never seen before yourself - including potential surprises.