Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

HUD

-

Switch head up display


CommandArgument DatatypeDefaultMinMax
Format:HUDShow = Obj | Sim | Off, STRING---
  Antialias = On | OffSTRING - --
Python:HUD(show,antialias)
Menu:Window > Menus
Keys:<Insert>  -  Toggle display of the HUD
<I>  -  As above, since some keyboards are missing the Insert key
<Ctrl>+<Insert>  -  Switch between object properties and simulation parameters
<Ctrl>+<I>  -  As above, since some keyboards are missing the Insert key
Related:Menu, SeqSelector , Console, FullScreen
Required:


The HUD command configures the transparent head up display, which shows atom and object properties as well as the simulation parameters and YASARA Dynamics and above.

The Show parameter chooses between object properties and simulation parameters to be shown in the right HUD.

If the Antialias parameter is set to 'on', the HUD is displayed using a smaller, antialiased font.

In the Twinset WHAT IF, which never shows a HUD, this command prints the current HUD contents.

Example 1:
HUD Obj

Show head up display with object properties.


Example 2:
HUD Sim

Show head up display with simulation parameters.


Example 3:
HUD Antialias=On

Activate antialiasing in the HUD.


Example 4:
HUD Off

Do not show head up display.