Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Getting started

As you can read this manual, YASARA has been installed successfully. For your convenience, YASARA does not use an invasive installer. If you use Windows, just pull the YASARA icon anywhere in the Start menu to place a shortcut there. Simply delete the directory to uninstall.

When you run YASARA, you will see a startup screen. After a few seconds, you are ready to go.

Click on 'Help > Play help movie > Working with YASARA', and spend a few minutes to see how YASARA works...

If you work with Windows and have not installed Python yet, click Help > Install program > Python. This will enable many useful plugins.

If something does not work as expected, look at the description of the command. Most likely, you will find the solution there.

If anything goes really wrong, please visit the Troubleshooting-section.

Here are the most important hints to get you started:
  • If you do not like the blending windows, go to Window > Animation
  • If you do not like the background colors, go to View > Color > Background
  • If you install YASARA as a different user (not yourself), you must run it once as this other user. Look here for more details.