Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

GroupDistance

-

Get distance between two atom groups


CommandArgumentDatatypeDefault Min Max
Format: GroupDistance Atom selection 1,SELECTION ---
   Atom selection 2SELECTION ---
Python: result = GroupDistance(selection1,selection2)
Menu:Analyze > Geometry > Group distance
Related:GroupAngle, GroupDihedral , Distance, Angle , Dihedral
Required:


The GroupDistance command calculates the distance between the geometric centers of the two atom selections.

A typical application would be to calculate the distance between the geometric centers of amino acid side-chains or entire protein domains.

This command cannot be used while a simulation with periodic boundaries is running, since geometric centers are then ambiguous.

Example 1:
GroupDistance Mol A,Mol B

Calculate the distance between the geometric centers of molecules A and B.


Example 2:
dis = GroupDistance CG CD? CE? CZ Res Phe 30,CG CD? CE? CZ Res Phe 52

Calculate the distance between the phenyl rings of residues Phe 30 and Phe 52, and assign the result to variable 'dis'.