Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

GroupDihedral

-

Get dihedral angle between two atom groups


CommandArgument DatatypeDefaultMinMax
Format:GroupDihedralAtom selection 1,SELECTION - --
  Atom selection 2SELECTION---
Python:result = GroupDihedral(selection1,selection2)
Menu:Analyze > Geometry > Group dihedral
Related:GroupDistance, GroupAngle , Angle, Distance , Dihedral
Required:


The GroupDihedral command obtains two planes that optimally fit the atom 'point clouds' in the two selections and then calculates the dihedral angle between these planes.

A typical application would be to calculate the dihedral angle between two planar side-chains like Phe, Trp or DNA bases.

The value returned by this command falls in the range [0..90], corresponding to parallel and orthogonal planes.

This command cannot be used while a simulation with periodic boundaries is running, since regression lines are then ambiguous.

Example 1:
GroupDihedral Sidechain Res A 5,Sidechain Res G 6

Calculate the dihedral angle between the planes through the adenine base of residue 5 and the guanine base of residue 6.


Example 2:
dih = GroupDihedral CG CD? CE? CZ Res Phe 30,CG CD? CE? CZ Res Phe 52

Calculate the dihedral angle between the planes through the phenly rings of residues 30 and 52, and assign the result to variable 'dih'.