Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

GroupAngle

-

Get angle between two atom groups


CommandArgumentDatatypeDefault Min Max
Format: GroupAngle Atom selection 1,SELECTION ---
   Atom selection 2SELECTION ---
Python: result = GroupAngle(selection1,selection2)
Menu:Analyze > Geometry > Group angle
Related:GroupDistance, GroupDihedral , Angle, Distance , Dihedral
Required:


The GroupAngle command obtains two regression lines that optimally fit the atom 'point clouds' in the two selections and then calculates the angle between these lines.

A typical application would be to calculate the angle between two alpha-helices by selecting the backbone atoms of the two helices, provided that the helices are not too short (i.e. just one turn) to obtain a meaningful result.

While the maximum angle between two lines can normally only be 90 degrees, the value returned by this command actually falls in the range [0..180], because any directionality in the atom selection is conserved. This makes for example sure that the calculated angle between two parallel helices is 0, while the angle between two antiparallel helices is 180 degrees.

This command cannot be used while a simulation with periodic boundaries is running, since regression lines are then ambiguous.

Example 1:
GroupAngle CA Res 100-130,CA Res 200-220

Calculate the angle between the two regression lines defined by the Calpha atoms of residues 100-130 and residues 200-220.


Example 2:
ang = GroupAngle Backbone Res 100-130,Backbone Res 200-220

As above, but use all backbone atoms and assign the result to variable 'ang'.