Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

GrabPrev

-

Grab previous object for mouse movement


CommandArgumentDatatypeDefault Min Max
Format: GrabPrev - --
Python:GrabPrev()
Menu: This command is mainly useful for macros. There is no menu entry.
Keys:<Ctrl>+<Shift>  -  Run the GrabPrev command
Related:GrabNext, Grab
Required:


The GrabPrev command selects the previous active object in the list for interactive movement.

Since the <Ctrl>+<Shift> provides a quick shortcut, this command is mainly helpful in connection with special input devices like the Spaceball, where YASARA allows you to assign commands to the individual buttons.

Example:
GrabPrev

From the currently grabbed object, move to the previous active and visible object. If none is found, grab the entire scene.