Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Grab<Obj|All>

-

Grab object or scene for mouse movement


CommandArgumentDatatypeDefault Min Max
Format: Grab<Obj|All> Selection SELECTION- - -
Python: Grab<Obj|All>(selection1)
Menu:Effects > Move > Object with mouse
Related:GrabNext, GrabPrev , Pos, AutoMove , AutoMoveTo, Ori , Rotate, AutoRotate , AutoRotateTo
Required:


The Grab command picks the selected object for interactive movement with the mouse.

The quickest way of issuing the Grab command is by clicking on the object name in the top right HUD . Clicking a second time runs the GrabAll command command to move the entire scene again.

Normally, you use the <Shift> key to quickly grab objects one after another.

Example 1:
GrabObj 1crn

Use the mouse to move and rotate object 1crn only, fix all other objects.


Example 2:
GrabAll

Use the mouse to move and rotate the entire scene.