Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Go

-

Go to another position in the macro


CommandArgument DatatypeDefaultMinMax
Format:GoBack | Forward | LabelName STRING---
Python:This command is mainly for internal use. It is not available in Python.
Menu:Options > Macro & Movie > Go
Related:PlayMacro, StopMacro
Required:


The Go command jumps to a specified label in a running macro. A label is just a name followed by a colon. You can also use the back- and forward-icons in the top menu line. The macro should be written in such a way that every label starts a new section, usually with the commands Clear or LoadSce. This makes sure that a jump to this position sets the scene to a defined state and does not cause errors subsequently.

The Go command also disables all automatic movements and rotations of the scene and removes the ContinueButton.

Example 1:
Go Back

Jump to the previous label in the current macro.


Example 2:
Go Forward

Jump to the next label in the current macro.


Example 3:
Go MyLabel

Jump to the label named 'MyLabel'.