Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Global coordinate system - The coordinate system of the scene

All objects are positioned and oriented with respect to YASARA's global coordinate system. Only these global coordinates change if you move or rotate an object. Unless you grab a single object, all objects rotate together around their common geometric center (or around the center of the simulation cell if one has been defined).

Figure: YASARA's left-handed coordinate system. The X-axis (red) points to the right, the Y-axis (green) points up and the Z-axis (blue) points into the screen. You can use the first three fingers of your left hand to mimic these arrows.

Figure: YASARA's right-handed coordinate system . The X-axis (red) points to the left, the Y-axis (green) points up and the Z-axis (blue) points into the screen. You can use the first three fingers of your right hand to mimic these arrows.