Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Gaps in a molecule are bridged by default

If you load a structure determined by X-ray crystallography, there are often stretches of residues that were not visible in the electron density map, the structure has a gap. Because there is no way to distinguish between a true gap and an unintentional gap created during modeling, YASARA ignores gaps unless they are explicitly marked as true gaps. This can be helpful, as you get for example a continuous ribbon display that bridges gaps, but sometimes it is not what you want. In these cases, just delete all peptide bonds that are longer than 3 Angstroms: Go to Edit > Delete > Bond, click on atom name 'C' in the first window, 'N' in the second window and input 3 A as the minimum bond length required for deletion.

If after deleting the bonds, you save the structure as a PDB file and load it again, all bonds will reappear, because PDB files do not store information about deleted bonds. In such a case, you might consider adding a split point (an explicit chain break) at the position of the gap: Go to Edit > Split > Residue and select the residue after the gap. Split points appear as 'TER' entries in the PDB file and as vertical lines in the sequence selector at the bottom.