Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

FullScreen

-

Switch fullscreen mode on/off


CommandArgumentDatatypeDefault Min Max
Format: FullScreen Flag = On | OffSTRING ---
Python: FullScreen(flag)
Menu:Window > Cover full screen
Related: ScreenSize , Console, Menu
Required:


The FullScreen command switches to or from fullscreen mode, where YASARA covers the entire screen.

In fullscreen mode, the ScreenSize command changes the actual screen resolution.

Running in fullscreen mode is useful when the screen resolution is limited (e.g. DTI Virtual Window 3D Display) or when using YASARA to show a multimedia presentation.

If going fullscreen results in a red error box 'Essential video mode not supported' , this most likely means that the resolution of your screen (or the combined resolution of multiple screens joined with TwinView etc.) is too high for YASARA.

Example 1:
FullScreen On

Switch to fullscreen mode, no other windows will be visible.


Example 2:
FullScreen Off

Switch back to window mode, other windows become accessible again.