Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Floats remember their precision

Floats are numbers with a decimal point and an optional exponent. If you specify an exponent or just a dot without decimal digits, calculations will be done at maximum precision. Otherwise the result will be rounded to the number of digits after the decimal point.

Examples:
a = 5.000
A float with a precision of three decimal digits
b = 4e0
A float with maximum precision (4*10^0 = 4)
c = 3.
Just a dot without decimal digits also gives maximum precision
d = -2.5e3
A float with maximum precision (-2.5*10^3 = -2500)
e = 7.345e-4
Another float with maximum precision (7.345*10^-4 = 0.0007345)
f = 0.0034
A float with a precision of four decimal digits