Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Free<Atom|Res|Mol|Obj|All>

-

Free atoms during simulation


CommandArgument DatatypeDefaultMinMax
Format:Free<Atom|Res|Mol|Obj|All> SelectionSELECTION - --
Python:Free<Atom|Res|Mol|Obj|All>(selection1)
Menu:Simulation > Free
Related: Fix
Required:


The Free command makes sure that atoms fixed before are allowed again to move during a simulation.

If you are using a non-periodic simulation cell that includes only part of a protein, YASARA automatically fixes atoms that are close to the cell wall, because they feel large repulsive wall forces. Freeing those atoms is not recommended.

Example:
FreeAtom Sidechain

Free all side-chain atoms during a simulation.