Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

FramesPerSec

-

Set screen update frequency


CommandArgument DatatypeDefaultMinMax
Format:FramesPerSec Number = Screen update frequency in frames per second,INT---
  RedrawIdle = On | Off STRINGOn- -
Python:FramesPerSec(number,redrawidle=None)
Menu:Window > Update frequency
Required:


The FramesPerSec command specifies how often (per second) YASARA should redraw the window. Higher values result in smoother movements. Since today's TFT monitors update the display 60 times a second, choosing a value greater than 60 is not really needed.

For optimal visual quality (i.e. no tearing effects), YASARA should redraw the window in sync with your monitor, ignoring the FramesPerSec setting alltogether. This approach is taken whenever possible, but some video drivers either do not support it, or require you to activate it in the video driver's control panel. In this case YASARA will stick the the FramesPerSec setting and display the warning "Screen update not synchronized". Hints how to solve this issue can be found here .

The RedrawIdle parameter defines how screen redraws are handled when YASARA becomes idle. If set to 'yes', YASARA will continue to redraw the screen (at a lower frequency), so that e.g. fireflies around marked atoms continue to rotate. If set to 'no', the screen will not be updated, thus minimizing CPU usage and extending notebook battery life.

Example 1:
FramesPerSec 60,RedrawIdle=Yes

Redraw the screen 60 times per second and continue to redraw when idle (albeit at lower rate).


Example 2:
FramesPerSec 30,RedrawIdle=No

Redraw the screen 30 times per second, but not when YASARA is idle (to save CPU power and notebook battery).