Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

FormEnergy<Atom|Res|Mol|Obj|All>

-

Calculate formation energies


CommandArgument DatatypeDefaultMinMax
Format:FormEnergy<Atom|Res|Mol|Obj|All> Selection SELECTION- - -
Python: resultlist = FormEnergy<Atom|Res|Mol|Obj|All>(selection1)
Menu: Analyze > Energy > Formation
Related: QuantumMechanics , Optimize, Energy , EnergyUnit
Required:


The FormEnergy command calculates the energy of formation for the selected atoms using the current QuantumMechanics method. An independent calculation is run for each object, hence selected atoms in different objects do not feel each others presence.

The energy of formation is the heat released or absorbed (enthalpy change) during the formation of a molecule from its elements, at constant pressure. An alternative name is therefore 'heat of formation'. The elements are assumed to be in their standard states (the most stable form at 25 degrees Celsius and 1 atm, e.g. the O2 molecule for oxygen).

By calculating the energy of formation, you can compare different conformations of one molecule, as well as different molecules built from the same atoms to to find the most likely one, i.e. the one with the lowest energy of formation.

If YASARA is set to work in vacuo (i.e. the pH model has been deactivated), the formation energy is also calculated in vacuo, otherwise the COSMO implicit solvent model (Klamt A (1995) J. Phys. Chem. 99, 2224) is applied. To illustrate the difference, the table below shows the heat of formation calculated for the amino acid glycine, first as a zwitterion (with NH3+ and COO- groups) and then as a non-ionic tautomer (NH2 and COOH groups):

Energy (kcal/mol) NH3-CH2-COO NH2-CH2-COOH
in vacuo -59.2 -101.5
in solution -123.9 -119.0

It is obvious that in vacuo the non-ionic tautomer is more stable, while the zwitterion sharply wins in solution.

Being a quantum chemistry method, the number of selected atoms per object is limited, as memory requirements grow quadratically.

As with all energy calculations, the structure should have been optimized before to obtain meaningful results.

Results are returned in units of either kJ/mol or kcal/mol, depending on the current EnergyUnit.

Example 1:
FormEnergyObj 3

Calculate the formation energy of object 3.


Example 2:
energylist() = FormEnergyRes ATP

Calculate the formation energies of all ATP residues and assign the result (per object) to the list 'energylist'.



Example macro:

# EXAMPLE FormEnergy
# Requires YASARA Dynamics
Clear
QuantumMechanics AM1
phlist='None','7'
envlist='vacuo','water'
Style BallStick
# Calculate AM1 formation energies fist in vacuo, then in water
for i=1 to 2
  # Work either in vacuo or water
  pH (phlist(i)),update=no
  ceny=(1.50-i)*4.5
  # Build two glycines, one neutral gas-phase molecule and one zwitterion.
  for j=1 to 2
    gly = BuildRes Gly
    AddHydObj (gly)
    if j==1
      # Move hydrogen from the N to the O
      AddHydAtom OT2 Obj (gly),1
      DelAtom H Obj (gly) with maximum distance from OT1 Obj (gly)
    PosObj (gly),X=((-1.5+j)*7),Y=(ceny*1.5),Z=7
    # Optimize the structure
    OptimizeObj (gly)
    # And calculate formation energy in the current environment
    # (actually we could also get it from the 'Optimize' command directly)
    heat = FormEnergyObj (gly)
    LabelObj (gly),'(0.00+heat)',Height=0.7,Color=White,Y=-2.2
    # Remember result
    Tabulate (heat)
  LabelAll 'Heat of formation in (envlist(i)) [(EnergyUnit)]',Height=0.45,Color=Yellow,Y=(ceny+1.65)
CenterObj all
AutoRotateObj all,Y=0.5
HUD Off

Figure: Result of the example macro above.