Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Force<Atom|Res|Mol|Obj|All>

-

Set/get force on atoms


CommandArgument DatatypeDefaultMinMax
Format:Force<Atom|Res|Mol|Obj|All> Selection,SELECTION - --
  X = X-Force in pN,FLOAT - --
  Y = Y-Force in pN,FLOAT - --
  Z = Z-Force in pNFLOAT - --
Python:Force<Atom|Res|Mol|Obj|All>(selection1,x,y,z)
resultlist = Force<Atom|Res|Mol|Obj|All>(selection1)
Menu: This command is mainly useful for macros. There is no menu entry.
Related:Pos
Required:


The Force command either returns the current net force vector acting on the selected atoms, or it adds to the current force vectors of the selected atoms. In the latter case, the command can be used to steer a simulation into a certain direction. As only the current force is affected, the Force command must be run at every simulation step to exert a permanent force:


Console Off
# Start in simulated annealing mode to remove
# the excess kinetic energy added with 'Force'
TempCtrl Anneal
SimSteps 1
Sim On
while 1
  # Force all atoms upwards with 100 pN per atom
  ForceAtom all,Y=100
  # Let the macro wait for one simulation cycle
  Wait 1


Example 1:
ForceAtom 123,Y=10

Add 10 PicoNewton to the Y-component of the force acting on atom 123.


Example 2:
ForceMol B,X=5,Z=7

Add 5 PicoNewton to the X-components and 7 PicoNewton to the Z-components of the forces acting on the atoms in molecule B.


Example 3:
scalar,x,y,z = ForceAtom 234

Assign the force acting on atom 234 to variables 'scalar', 'x', 'y' and 'z'. The latter three get assigned the cartesian components, 'scalar' gets the length of the vector.


Example 4:
scalar = ForceObj 5

Assign the scalar net force acting on object 5 to variable 'scalar'.