Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Font

-

Set font for 3D letters


CommandArgument DatatypeDefaultMinMax
Format:FontName = Font name or number, STRING- - -
   Height = Font size in Angstroms or percent of text object height, FLOAT-- -
   Color = Font color,RGBCOLOR ---
   Spacing = Line spacing,FLOAT-- -
   Depth = Font depth in Å, FLOAT-- -
   DepthCol = Font depth colorRGBCOLOR-- -
Python:Font(name,height,color,spacing,depth,depthcol)
Menu: Effects > Text > Font
Related:FontFog , MakeTextObj, PosText , Print, PrintObj , PrintCon, PrintHUD
Required:


YASARA currently supports four fonts: Arial, Times, Baikal and Symbol. Do not choose font sizes smaller than one Angstrom, as the spacing between characters will become increasingly inaccurate.

Example 1:
Font Arial,Height=2,Color=Yellow,Spacing=1.5,Depth=5,DepthCol=Red

Choose a yellow Arial font, 2 Angstroms high, a 5 Angstrom deep red extrusion in 3D and a line spacing of 1.5.


Example 2:
Font Times,Height=10%,Color=Green,Spacing=2,Depth=0

Choose a green Times font without depth, 10% of current text object high, and double line spacing.



Example macro:

# EXAMPLE Font
# Requires YASARA Model
Clear
MakeTextObj FontTest,Width=40,Height=20
PrintObj FontTest
PosText 50%,100%,justify=center
Font Baikal,Height=5%,Color=Yellow,Spacing=1.5,Depth=50,DepthCol=Red
Print "YASARA Font Test\n\n"
Font Arial
Print "This is font Arial\n"
Font Times,Color=Green,DepthCol=008000
Print "This is font Times\n"
Font Baikal,Color=Cyan,DepthCol=Blue
Print "This is font Baikal\n"
Font Symbol,Color=Blue,DepthCol=000080
Print "This is font Symbol\n"
PosObj FontTest,3,-10,25
OriObj FontTest,8.4,7.7,0

Figure: Result of the example macro above.