Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

FlipTab

-

Flip table axes


CommandArgument DatatypeDefaultMinMax
Format:FlipTabTable selection, SELECTION---
  FirstDim = Columns | Rows | Pages, STRING- - -
   SecondDim = Columns | Rows | Pages STRING- - -
Python: FlipTab(selection1,firstdim,seconddim)
Menu:Options > Table > Flip
Related: Tabulate , Tab, SelectTab , MakeTab, ShowTab , DelTab, LoadTab , SaveTab, FlipTab
Required:


The FlipTab command transforms the order of the cells in a table.

If only the first dimension 'FirstDim' is specified, the command simply flips the direction of the specified axis, which mirrors the table.

If two dimensions are specified, then FlipTab flips the two table axes. This flip can best be visualized by a simple relabeling of the axes, e.g. FlipTab 1,Columns,Rows changes the name of the 'Columns' axis to 'Rows' and vice versa. This is the same as mirroring the table horizontally and rotating it counter-clockwise by 90 degrees.

This command is especially useful if tables are exported for use by another program which expects a specific order of table cells.

Example 1:
FlipTab 2,FirstDim=Columns

Flip the columns in table 2, i.e. mirror the table horizontally.


Example 2:
FlipTab default,FirstDim=Rows,SecondDim=Pages

Flip the rows in table 'default' with the pages, i.e. turn the 'rows' dimension into the 'page' dimension and vice versa.