Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Fix<Atom|Res|Mol|Obj|All>

-

Fix atoms during simulation


CommandArgument DatatypeDefaultMinMax
Format:Fix<Atom|Res|Mol|Obj|All> SelectionSELECTION - --
Python:Fix<Atom|Res|Mol|Obj|All>(selection1)
Menu:Simulation > Fix
Related: Free
Required:


The Fix command makes sure that the selected atoms do not move during a simulation or Experiment. To indicate the fixed state, the atoms are additionally colored yellow.

Fixing can be reversed with the Free command.

  • When the NOVA force field is used and at least one atom in a planar group is fixed, YASARA fixes also all the other atoms in the group to avoid numerical instabilities in the way NOVA treats planarity.

  • When a molecule is partly outside the non-periodic cell, atoms close to the cell wall are fixed automatically to avoid geometry distortions caused by the repulsive cell wall forces.

Example:
FixAtom Backbone

Fix all backbone atoms during a simulation.



Example macro:

# EXAMPLE Fix
# Requires YASARA Dynamics
Clear
LoadPDB 1crn
Clean
FixAtom Backbone
StickAtom Sidechain
Sim On
Wait 20

Figure: Result of the example macro above.