Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

FillCellWater

-

Fill simulation cell with water


CommandArgumentDatatypeDefault Min Max
Format: FillCellWater Density = Water density in g/ml,FLOAT1.0- -
   Probe = Water probe radius in Å,FLOAT1.2--
  BumpSum = Maximum allowed sum of water bumps in ÅFLOAT 1.0 --
Python:result = FillCellWater(density=None,probe=None,bumpsum=None)
Menu:Simulation > Fill simulation cell
Related:FillCellObj, Cell , Experiment, PressureCtrl
Required:


The FillCellWater command places water molecules (taken from an infinitely large snapshot of a water simulation at the chosen density) at all empty spots in the simulation cell. 'Empty' is defined by the water probe radius 'Probe' and the allowed sum of bumps 'BumpSum' with atoms already in the cell. The command does not consider the density of water molecules already present.

Filling the simulation cell with water at precisely the right density is a non-trivial task, especially in case of crystal cells that are packed with proteins. For realistic molecular dynamics simulations, one should use 'Experiment Neutralize' instead, which uses an energy-based algorithm to delete unlikely water molecules, and additionally places counter ions and predicts protonation states. FillCellWater is however much faster and also works in non-periodic cells.

Instructions on how to fill the cell with other solvents are provided at the FillCellObj command.

Example:
obj = FillCellWater Density=0.98,Probe=1.2,BumpSum=1.8

Fill simulation cell with 0.98g/ml water molecules, so that the sum of all bumps per water molecule (with 1.2 A radius) is less than 1.8 A. Assign the number of the water object to variable 'obj'.



Example macro:

# EXAMPLE FillCellWater
# Requires YASARA Dynamics
Clear
LoadPDB 1crn
CleanObj 1crn
Cell 40,40,40
Pos Z=20
ForceField Amber96
FillCellWater Density=1.0,Probe=1.2,BumpSum=1.0
Style Ball
StickObj Water

Figure: Result of the example macro above.