Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

FileSize

-

Get file size


CommandArgument DatatypeDefaultMinMax
Format:FileSize Filename = Filename to checkSTRING ---
Python: result = FileSize(filename)
Menu:This command is mainly useful for macros. There is no menu entry.
Related:Shell, CD , PWD, DelFile
Required:


The FileSize command returns the size of the specified file in bytes. If the file does not exists, the size 0 is returned. FileSize can therefore be used to check if a file exists. The returned number is an integer for files smaller than 2^31 bytes, otherwise a floating point number.

Example 1:
FileSize 1crn.pdb

Display the size of file 1crn.pdb.


Example 2:
size = FileSize 1crn.pdb

Assign the size 1crn.pdb (in bytes) to variable 'size'.