Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

FileSelectionMenu

-

Add a menu allowing to select files

This keyword adds a window with a file browser. Set the 'MultipleSelections' flag to 'Yes' if the user is allowed to select more than one list entry and to 'No' otherwise. The Filename keyword specifies a wildcard with the initial path. Use forward slashes also under Windows.

The jth selected filename in the ith selection menu can be accessed by the Python plugin as yasara.selection[i].filename[j] (see below).

Example:

MainMenu: File
  PullDownMenu: Load
    PopUpMenu after PDB file: _N_MR ensemble
      FileSelectionMenu: Select a PDB file containing an NMR ensemble
        MultipleSelections: No
        Filename: pdb/*.pdb
      Request: LoadEnsemble