Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Experiment

-

Choose and control experiments


CommandArgumentDatatypeDefault Min Max
Format: Experiment Minimization | Neutralization | Morphing | NMRFolding | On | Pause | Continue | OffSTRING - --
Python:Experiment(noname1)
ExperimentMinimization(convergence=None)
ExperimentNeutralization(waterdensity=None,nacl=None,ph=None,pkafile=None,speed=None)
ExperimentMorphing(startobj=None,endobj=None,structures=None,structurefile=None,morphforce=None)
ExperimentNMRFolding(startobj=None,restrainfile=None,structures=None,structurefile=None)
Menu:Options > Control experiment
Keys: <Pause> or <P>  -  Pause/continue all tasks, including the experiment
Required:


Experiments are YASARA's way of handling complicated things at the touch of a button. During an experiment, YASARA takes over control. As in real life, you should not interfere too much while YASARA is cooking. E.g. if you try to delete some atoms or change the simulation parameters in the middle of a 'Neutralization Experiment', YASARA will ask you to stop the experiment first. Like molecular dynamics simulations, experiments cannot be undone.

When you start an experiment ('Experiment On'), YASARA performs various checks and reassigns the force field parameters. If you want to modify the force field, e.g. by adding distance constraints or modifying atom charges, do that immediately after starting the experiment, not before. Otherwise the changes may be undone.

The 'Experiment Pause' command only pauses YASARA's control over the scene, e.g. if a simulation is running as part of the experiment, it will continue running until it is paused separately or until YASARA is paused completely by pressing the <Pause> key.

Example 1:
Experiment Minimization

Prepare an energy minimization experiment, see example macro below. YASARA creates a cell and starts with a steepest descent minimization using the current simulation parameters. Regions with strong bumps are initially minimized without electrostatic interactions to avoid short-range energy traps. As soon as the bumps have been removed, a simulated annealing minimization is done until the energy (calculated every 200 steps) converges. This procedure thus moves the minimized object to a deep energy minimum in the neighborhood, which is not necessarily the global energy minimum. To describe this method in a materials & methods section, the following text could be used: "To remove bumps and correct the covalent geometry, the structure was energy-minimized with the .... force field [ref ], using a ... A force cutoff and (if applied) the Particle Mesh Ewald algorithm [ref] to treat longrange electrostatic interactions. After removal of conformational stress by a short steepest descent minimization, the procedure continued by simulated annealing (time step 2 fs, atom velocities scaled down by 0.9 every 10th step) until convergence was reached, i.e. no energy improvement was found for 200 steps.".


Example 2:
Experiment Neutralization

Prepare a cell neutralization and pKa prediction experiment, see example macro below. YASARA predicts pKa values for Asp, Glu, His and Lys residues using a method that has been calibrated on experimental pKa measurements and achieves a high overall accuracy, but does usually not capture very large shifts of special active site residues (resort to a different method for these and use the pKaRes command to override YASARA's predictions, also look at the pKa prediction result file for scientific details). These calculations are only possible with periodic boundaries. Based on the chosen pH, YASARA then assigns the protonation states. Asp and Glu are protonated if the predicted pKa is higher than the pH. His is protonated if the predicted pKa is higher than the pH and it does not accept a hydrogen bond, and deprotonated otherwise. Cys is deprotonated if the selected pH is higher than 8.7. Lys is deprotonated if the predicted pKa is lower than the pH. Tyr and Arg are not modified, because the (Y)AMBER force fields do not have default parameters for the deprotonated states. Then the simulation box is filled with water molecules, and Na/Cl counter ions are placed at the locations of the lowest/highest electrostatic potential until the cell is neutral and the requested NaCl concentration is reached (normally 0.9%). Finally a short MD simulation is run for the solvent, and water molecules are subsequently deleted until the water density has reached the requested value.


Example 3:
Experiment Morphing

Prepare a morphing experiment, see example macro below. YASARA transforms one structure into another during a simulated annealing minimization. This is done by applying forces that pull the atoms in the initial structure to their target coordinates. The RMSD to the target is monitored, and the pulling forces are increased when the morphing process gets stuck in a local minimum. Snapshots can be saved to create a movie of the transformation. Morphing requires that the order of atoms is the same in both objects, but the end object may contain fewer atoms. In this case no pulling force will be applied to those atoms that exist only in the starting structure.


Example 4:
Experiment NMRFolding

Prepare an NMR folding experiment, see example macro below. Note that YASARA Structure and the NMR Structure Determination Module are required. YASARA folds a usually linear peptide chain to a globular conformation using distance- and dihedral angle restraints derived from an NMR spectrum. This is done quickly using internal coordinates, i.e. by changing torsion angles. The torsion angles are picked randomly from knowledge based potentials defined by one of the YASARA force fields. During the folding process, the restraints are added sequentially, from short- to long-ranged ones. The result is not accurate, but captures the overall protein topology and can quickly be converted to a realistic structure by molecular dynamics refinement.


Example 5:
Experiment On

Start the experiment chosen before.


Example 6:
Experiment Pause

Temporarily hold a running experiment.


Example 7:
Experiment Continue

Continue a paused experiment.


Example 8:
Experiment Off

Stop the current experiment.



Example macro 1:

# EXAMPLE Experiment Morphing
# Requires YASARA Dynamics
Clear
# Load the starting structure
LoadPDB 1crn
# Load and clean the target structure
LoadPDB 1crn_md
Clean
Cell Auto
# Prepare morphing experiment
Experiment Morphing
  # Initial start structure
  StartObj 1crn
  # Final end structure
  EndObj 1crn_md
  # Number of intermediate structures to save
  Structures 10
  # Filename for intermediate structures (will be incremented)
  StructureFile morph0000
  # Initial pulling force in Piconewton
  MorphForce 10
# Start experiment
Experiment On
# Wait till end of experiment
Wait ExpEnd

Figure: Result of the example macro 1 above.



Example macro 2:

# EXAMPLE Experiment Neutralization
# Requires YASARA Dynamics
# IMPORTANT: Look at the *.pka result file for further details and hints.
Clear
LoadPDB 1crn
# Mutate one arginine to glutamate, net charge is now -2
SwapRes Arg 17,Glu
Clean
Cell Auto
ForceField Amber96
Cutoff 7.86
Boundary periodic
# Prepare neutralization experiment
Experiment Neutralization
  # Fill the cell with water at a density of 1.0 g/cm^3
  WaterDensity 1.0
  # And NaCl counter ions with 0.9%
  NaCl 0.9
  # Protonate ionizable groups according to pH 7.0
  pH 7.0
  # Save pKa predictions as dat/1crn_mutant.pka
  pKaFile 1crn_mutant
  # Finish quickly (final water density will be OK, but not exact)
  Speed Fast
# Start experiment
Experiment On
# Wait till end of experiment
Wait ExpEnd

Figure: Result of the example macro 2 above.



Example macro 3:

# EXAMPLE Experiment Minimization
# Requires YASARA Dynamics
Clear
LoadPDB 1crn
Clean
ForceField Nova
Cutoff 10.48
Boundary Wall
# Prepare energy minimization experiment
Experiment Minimization
# Start experiment
Experiment On
# Wait till end of experiment
Wait ExpEnd

Figure: Result of the example macro 3 above.



Example macro 4:

# EXAMPLE Experiment NMRFolding
# Requires YASARA Structure and the NMR Module
Clear
# Build a linear peptide chain from the file sequence.fasta
BuildMol sequence.fasta
Clean
# We need a forcefield with knowledge based potentials for sampling
ForceField Yasara
SimSteps 500
# Fold the structures from the stretched out conformation
Experiment NMRFolding
  # The object to fold
  StartObj 1
  # The file(s) with NMR restraints (default extension is .tbl)
  RestrainFile restraints.tbl
  # The number of structures to generate
  Structures 1
  # The filename for the structures (digits will be incremented)
  StructureFile ensemble001
# Generate the structure
Experiment On
Wait 59
Style Tube

Figure: Result of the example macro 4 above.