Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Examples of selections needed in real-life

The following selection examples have at least once helped YASARA users to get what they wanted:

ListRes Asp Glu Atom O with bond to Element H
List all protonated Asp/Glu residues
ListRes Tyr Atom OH with 0 bonds to Element H
List all deprotonated tyrosines
ListRes Arg Atom NH? with 1 bond to Element H
List all neutral arginines
ListRes Cys Element S with 1 bond to all
List all negatively charged cysteines
ListRes His Atom HD1 and Atom HE2
List all protonated histidines
ListRes not Atom HD1 or not Atom HE2 and His
List all neutral histidines