Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

EnergyUnit

-

Set energy unit


CommandArgument DatatypeDefaultMinMax
Format:EnergyUnit kJ/mol | kcal/mol STRING- - -
Python: EnergyUnit(noname1)
Menu:Options > Energy unit
Related: Energy , BindEnergy, SolvEnergy
Required:


The EnergyUnit command switches between kJ/mol and kcal/mol as the unit of all calculated energies.

It is recommended to use the official SI unit kJ/mol, kcal/mol is supported for historical reasons.

Example 1:
EnergyUnit kJ/mol

Output all energies in units of kJ/mol.


Example 2:
EnergyUnit kcal/mol

Output all energies in units of kcal/mol.